ID: 987732134_987732137

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 987732134 987732137
Species Human (GRCh38) Human (GRCh38)
Location 5:21787351-21787373 5:21787370-21787392
Sequence CCTCTACCAGCAAACAAGATTAC TTACAACTTGCTGAAGGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 32, 4: 145} {0: 4, 1: 11, 2: 38, 3: 54, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!