|
Left Crispr |
Right Crispr |
| Crispr ID |
987744148 |
987744156 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:21948334-21948356
|
5:21948358-21948380
|
| Sequence |
CCACCCCTTGCATTAACATGCCC |
GGATGTGAAACATGGAGACAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 6, 2: 60, 3: 250, 4: 1048} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|