ID: 987774691_987774696

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 987774691 987774696
Species Human (GRCh38) Human (GRCh38)
Location 5:22349076-22349098 5:22349090-22349112
Sequence CCTTGTCCCTTCACCATATGAGG CATATGAGGTCACCATGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 23, 4: 195} {0: 1, 1: 0, 2: 0, 3: 10, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!