ID: 987811413_987811419

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 987811413 987811419
Species Human (GRCh38) Human (GRCh38)
Location 5:22840925-22840947 5:22840960-22840982
Sequence CCAGGAAAAGCAAGAAGAGTTGG AAGAACAAGGGGAAGGATGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 46, 4: 307} {0: 1, 1: 0, 2: 4, 3: 46, 4: 558}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!