ID: 987816079_987816090

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 987816079 987816090
Species Human (GRCh38) Human (GRCh38)
Location 5:22902113-22902135 5:22902143-22902165
Sequence CCCAGGCCCCTGAGTGCCCAGGA GGTCCAGAGCTGCAGCTGGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!