ID: 987816086_987816095

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 987816086 987816095
Species Human (GRCh38) Human (GRCh38)
Location 5:22902129-22902151 5:22902168-22902190
Sequence CCCAGGAATGTCTGGGTCCAGAG GCAGCTGCGCCCAGGAGCAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 24, 3: 101, 4: 625}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!