ID: 987817971_987817981

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 987817971 987817981
Species Human (GRCh38) Human (GRCh38)
Location 5:22928924-22928946 5:22928975-22928997
Sequence CCCTCCCCTTCCCTTTTCTTCTC GCCTAGGCATGCCACAGCACTGG
Strand - +
Off-target summary {0: 3, 1: 19, 2: 154, 3: 1322, 4: 7477} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!