ID: 987817973_987817981

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 987817973 987817981
Species Human (GRCh38) Human (GRCh38)
Location 5:22928928-22928950 5:22928975-22928997
Sequence CCCCTTCCCTTTTCTTCTCTTTT GCCTAGGCATGCCACAGCACTGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 110, 3: 912, 4: 5687} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!