ID: 987906785_987906798

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 987906785 987906798
Species Human (GRCh38) Human (GRCh38)
Location 5:24088209-24088231 5:24088257-24088279
Sequence CCCACCCAGGCCTCTGGCCACTC CTATTTCTTCCTGGGATGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 493} {0: 1, 1: 0, 2: 0, 3: 27, 4: 411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!