ID: 988083793_988083806

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 988083793 988083806
Species Human (GRCh38) Human (GRCh38)
Location 5:26446826-26446848 5:26446871-26446893
Sequence CCCATCAGGTCCTGCCCCTGACA TTCAAGTTGAGACTTGAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 32, 3: 264, 4: 1484} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!