ID: 988120409_988120413

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 988120409 988120413
Species Human (GRCh38) Human (GRCh38)
Location 5:26954124-26954146 5:26954174-26954196
Sequence CCATGTATCTCAATGTAATTTGG CTGGATTACCAGGTCTCTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 243} {0: 1, 1: 0, 2: 0, 3: 11, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!