ID: 988128391_988128400

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 988128391 988128400
Species Human (GRCh38) Human (GRCh38)
Location 5:27073080-27073102 5:27073123-27073145
Sequence CCCACCAAGGTCTCTAGCTAACA GACAGCACTGCAAGAGGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108} {0: 1, 1: 0, 2: 2, 3: 30, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!