ID: 988169203_988169206

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 988169203 988169206
Species Human (GRCh38) Human (GRCh38)
Location 5:27632840-27632862 5:27632868-27632890
Sequence CCAAAAGCTGACTTTCAAAAGGA GCGATCTGCAGAAGATGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 26, 3: 269, 4: 545} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!