ID: 988258129_988258133

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 988258129 988258133
Species Human (GRCh38) Human (GRCh38)
Location 5:28848119-28848141 5:28848162-28848184
Sequence CCTCAGTGAAGTTTCTAGGACGC AAATATTCTTTCTAAACTGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 91, 4: 830}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!