ID: 988264139_988264157

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 988264139 988264157
Species Human (GRCh38) Human (GRCh38)
Location 5:28928146-28928168 5:28928196-28928218
Sequence CCCGGGCCAAAGCCCATGCCCGG CCGCGGCCGGGCTGGCCCCGGGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 7, 3: 47, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!