ID: 988358230_988358233

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 988358230 988358233
Species Human (GRCh38) Human (GRCh38)
Location 5:30203477-30203499 5:30203512-30203534
Sequence CCTAACAGGGGATCTAAATCTTA ACAAAGGTCCGACCAGACCTAGG
Strand - +
Off-target summary No data {0: 42, 1: 113, 2: 102, 3: 58, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!