ID: 988441513_988441516

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 988441513 988441516
Species Human (GRCh38) Human (GRCh38)
Location 5:31239207-31239229 5:31239236-31239258
Sequence CCTAGAGGATATTGTGTCCAGCC TTTTACAGTTAAAGAAACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98} {0: 6, 1: 127, 2: 1127, 3: 4724, 4: 12363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!