ID: 988445336_988445344

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 988445336 988445344
Species Human (GRCh38) Human (GRCh38)
Location 5:31280107-31280129 5:31280130-31280152
Sequence CCACGCAAACCAGCAATTAACAC CTGAAGAAGGGGAAGGTGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56} {0: 1, 1: 0, 2: 4, 3: 38, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!