ID: 988459388_988459392

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 988459388 988459392
Species Human (GRCh38) Human (GRCh38)
Location 5:31419129-31419151 5:31419158-31419180
Sequence CCCAGGAAAGTGCACCGTGACAG ACAAAGCTTGTGTTTCAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81} {0: 1, 1: 0, 2: 2, 3: 17, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!