ID: 988459390_988459399

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 988459390 988459399
Species Human (GRCh38) Human (GRCh38)
Location 5:31419143-31419165 5:31419195-31419217
Sequence CCGTGACAGAAGCCAACAAAGCT ATGTTAATGCTAATGGGAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 206} {0: 1, 1: 0, 2: 0, 3: 5, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!