ID: 988459652_988459657

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 988459652 988459657
Species Human (GRCh38) Human (GRCh38)
Location 5:31422547-31422569 5:31422596-31422618
Sequence CCTTCACACTTCTCCTAAAACTT TGGAACCAACAACATTGGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 276} {0: 1, 1: 0, 2: 1, 3: 10, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!