ID: 988466267_988466274

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 988466267 988466274
Species Human (GRCh38) Human (GRCh38)
Location 5:31495638-31495660 5:31495683-31495705
Sequence CCAAAATACCATGAACTTGGTAA GGTACCAGAGGGACACCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 220} {0: 1, 1: 0, 2: 2, 3: 9, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!