ID: 988466268_988466274

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 988466268 988466274
Species Human (GRCh38) Human (GRCh38)
Location 5:31495646-31495668 5:31495683-31495705
Sequence CCATGAACTTGGTAAATGAGCAA GGTACCAGAGGGACACCCACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 9, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!