ID: 988478829_988478832

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 988478829 988478832
Species Human (GRCh38) Human (GRCh38)
Location 5:31612288-31612310 5:31612303-31612325
Sequence CCTGCTGTATTCACCTCACTGTA TCACTGTATTAAGAATAGGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 15, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!