ID: 988489154_988489160

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 988489154 988489160
Species Human (GRCh38) Human (GRCh38)
Location 5:31692267-31692289 5:31692293-31692315
Sequence CCGCGGAGCCTACGCCCACTCGG TTGCGCTGGCCCGCAAGCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 33, 3: 187, 4: 718} {0: 1, 1: 0, 2: 5, 3: 14, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!