|
Left Crispr |
Right Crispr |
| Crispr ID |
988494163 |
988494167 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:31730546-31730568
|
5:31730599-31730621
|
| Sequence |
CCAGGAGTTTGTGTGTGTGTGTG |
GTGTGTGTGTGTAAGGGAGTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 46, 2: 647, 3: 3719, 4: 5434} |
{0: 2, 1: 8, 2: 69, 3: 735, 4: 6301} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|