ID: 988504658_988504660

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 988504658 988504660
Species Human (GRCh38) Human (GRCh38)
Location 5:31811378-31811400 5:31811399-31811421
Sequence CCAGGGCTGCAGTGATGGTGTAA AATAGCTGACTCATCCCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 520, 4: 944} {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!