ID: 988506160_988506165

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 988506160 988506165
Species Human (GRCh38) Human (GRCh38)
Location 5:31825214-31825236 5:31825265-31825287
Sequence CCAAACGGAACCACATCTGGATT CCCGTACTACAGTTACAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 84} {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!