|
Left Crispr |
Right Crispr |
Crispr ID |
988508594 |
988508599 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:31846089-31846111
|
5:31846118-31846140
|
Sequence |
CCCCTCTGTGGTGGCTTTGGGTT |
ATTTTGTTTGTTTGGTTGGTTGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 4, 1: 130, 2: 406, 3: 1201, 4: 3017} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|