ID: 988516405_988516412

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 988516405 988516412
Species Human (GRCh38) Human (GRCh38)
Location 5:31908412-31908434 5:31908452-31908474
Sequence CCGGGAGATCTCAGACTGGCTGT AAGATGGTCTGTAGGAGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 179} {0: 1, 1: 0, 2: 3, 3: 26, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!