ID: 988530744_988530747

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 988530744 988530747
Species Human (GRCh38) Human (GRCh38)
Location 5:32025128-32025150 5:32025152-32025174
Sequence CCTAGAAAGAAAGGAAGGAAAAA AAGGAAGGAAAGAAGCAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 47, 3: 527, 4: 4692} {0: 1, 1: 4, 2: 66, 3: 868, 4: 4242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!