ID: 988530744_988530752

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 988530744 988530752
Species Human (GRCh38) Human (GRCh38)
Location 5:32025128-32025150 5:32025181-32025203
Sequence CCTAGAAAGAAAGGAAGGAAAAA TATTGATCTGGGGAAGGCAGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 47, 3: 527, 4: 4692} {0: 1, 1: 0, 2: 1, 3: 25, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!