ID: 988538288_988538300

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 988538288 988538300
Species Human (GRCh38) Human (GRCh38)
Location 5:32087833-32087855 5:32087878-32087900
Sequence CCGGGGCTGGAGGTGGGAGCTCC GGGGCCAGACCTCCTCCCCGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 20, 3: 144, 4: 748} {0: 1, 1: 0, 2: 0, 3: 27, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!