ID: 988551471_988551481

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 988551471 988551481
Species Human (GRCh38) Human (GRCh38)
Location 5:32204564-32204586 5:32204586-32204608
Sequence CCTTGACCCTCTCTCCGCTCCTC CCAGACCACTCTTGGGGGTATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!