ID: 988557788_988557798

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 988557788 988557798
Species Human (GRCh38) Human (GRCh38)
Location 5:32253064-32253086 5:32253081-32253103
Sequence CCCCCACCCCACCCACGAGGGGA AGGGGACATTTGGCAATACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 372} {0: 2, 1: 48, 2: 315, 3: 877, 4: 1429}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!