ID: 988563068_988563072

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 988563068 988563072
Species Human (GRCh38) Human (GRCh38)
Location 5:32298257-32298279 5:32298278-32298300
Sequence CCATGGAAACACAGACGGATCAC ACCACAGAGGGCCCCACAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 107} {0: 1, 1: 0, 2: 3, 3: 22, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!