ID: 988577965_988577978

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 988577965 988577978
Species Human (GRCh38) Human (GRCh38)
Location 5:32444709-32444731 5:32444761-32444783
Sequence CCTCTGCCCCGCTCCTCCTCAGC TGCGCAGGCGCGCCTGTGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 115, 4: 908} {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!