ID: 988577972_988577979

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 988577972 988577979
Species Human (GRCh38) Human (GRCh38)
Location 5:32444742-32444764 5:32444769-32444791
Sequence CCGCCGCCTCCGACCGCACTGCG CGCGCCTGTGCTCGGCATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 232} {0: 1, 1: 0, 2: 0, 3: 2, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!