ID: 988595230_988595237

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 988595230 988595237
Species Human (GRCh38) Human (GRCh38)
Location 5:32585022-32585044 5:32585055-32585077
Sequence CCTCTTGCCTTCTGTGAACTCCC AGGACTTCAATACAGGAATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 311} {0: 1, 1: 0, 2: 9, 3: 112, 4: 675}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!