ID: 988623418_988623425

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 988623418 988623425
Species Human (GRCh38) Human (GRCh38)
Location 5:32846531-32846553 5:32846580-32846602
Sequence CCCTTAAACCCAGGTAAATTCAG ACTCTCTGCAGTGTTGGCTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 30, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!