ID: 988655693_988655705

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 988655693 988655705
Species Human (GRCh38) Human (GRCh38)
Location 5:33209421-33209443 5:33209466-33209488
Sequence CCTGCCACCAGAAGGTTTGCTGA GGCTCCTTGAGGTTATCTACTGG
Strand - +
Off-target summary {0: 13, 1: 55, 2: 40, 3: 48, 4: 202} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!