ID: 988655696_988655700

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 988655696 988655700
Species Human (GRCh38) Human (GRCh38)
Location 5:33209425-33209447 5:33209445-33209467
Sequence CCACCAGAAGGTTTGCTGAGGGC GGCAGTCAGCCCCTGGCGCTGGG
Strand - +
Off-target summary {0: 19, 1: 38, 2: 37, 3: 61, 4: 155} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!