ID: 988676726_988676732

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 988676726 988676732
Species Human (GRCh38) Human (GRCh38)
Location 5:33440684-33440706 5:33440709-33440731
Sequence CCGGGAAGGTCCATGATTGTTCC ATAAAGTCAGAAGGGAGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 111} {0: 1, 1: 0, 2: 9, 3: 96, 4: 1035}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!