ID: 988683004_988683017

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 988683004 988683017
Species Human (GRCh38) Human (GRCh38)
Location 5:33502156-33502178 5:33502190-33502212
Sequence CCGCCCTAGCATCCAGGCTTCAG TGGGAGGCGGCCTGGGCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 179} {0: 1, 1: 0, 2: 4, 3: 33, 4: 470}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!