ID: 988687537_988687544

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 988687537 988687544
Species Human (GRCh38) Human (GRCh38)
Location 5:33539581-33539603 5:33539624-33539646
Sequence CCTTCTCAACTCAAGACCCACAG GCAGACTTAGAGGTATTCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 255} {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!