ID: 988695267_988695275

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 988695267 988695275
Species Human (GRCh38) Human (GRCh38)
Location 5:33615598-33615620 5:33615638-33615660
Sequence CCTCCCAGTGGGTGGTTTTAAAG TGGGGGTTTCAGCAATATCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 146} {0: 1, 1: 0, 2: 1, 3: 5, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!