ID: 988744717_988744720

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 988744717 988744720
Species Human (GRCh38) Human (GRCh38)
Location 5:34123101-34123123 5:34123118-34123140
Sequence CCCTGAGAGAGCTAGAAGGTCCA GGTCCAGGCAGAGAACCCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 107} {0: 1, 1: 0, 2: 3, 3: 26, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!