ID: 988819651_988819659

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 988819651 988819659
Species Human (GRCh38) Human (GRCh38)
Location 5:34868945-34868967 5:34868992-34869014
Sequence CCAAAACTGCAGAAATGAGTGCG TCTGGAGAGGCCCAGCACAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78} {0: 1, 1: 0, 2: 6, 3: 53, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!