ID: 988821230_988821234

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 988821230 988821234
Species Human (GRCh38) Human (GRCh38)
Location 5:34888129-34888151 5:34888156-34888178
Sequence CCTTCCACCATGTGAGTTTACAG AAGATGGCTGTCAATGAATCAGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 86, 3: 562, 4: 1430} {0: 1, 1: 3, 2: 21, 3: 67, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!