|
Left Crispr |
Right Crispr |
| Crispr ID |
988833485 |
988833488 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:35009316-35009338
|
5:35009337-35009359
|
| Sequence |
CCAGGCTTGGTGGCTCATGCCTG |
TGTAATCTTAGTACTTCAGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 402, 1: 15873, 2: 70880, 3: 158220, 4: 202551} |
{0: 1, 1: 26, 2: 558, 3: 8022, 4: 74574} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|